https://www.addgene.org/mol-bio-reference/sequencing-primers/

A list of sequencing primers that Addgene uses for sequence verification of deposited plasmids. ... T7, TAATACGACTCACTATAGGG T7 promoter, forward primer ...

https://www.thermofisher.com/order/catalog/product/N56002

Primer Length: 20 -mer. Primer Sequence: 5´d[TAATACGACTCACTATAGGG]3´. Primer Type: T7 Primers. Product Size: 2 µg. Purification: Gel-Purified. Quantity ...

https://www.thermofisher.com/order/catalog/product/SO118

The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 M aqueous solutions.Applications Sequencing of DNA ...

https://openwetware.org/wiki/Common_primer_sequences

Aug 21, 2007 ... M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT; M13 ... T7 universal primer: TAATACGACTCACTATAGGG; T7 Terminator: ...

https://www.genewiz.com/en/Public/Resources/Free-Universal-Primers

GENEWIZ offers a variety of free universal primers for sequencing. These free ... Name, Length(nt), Sequences(5'-3'). T7. 20. TAATACGACTCACTATAGGG.

https://www.lslabs.com/resources/universal-primer-list

Universal primers are PCR/sequencing primers that bind to a sequence found in many plasmid cloning ... T7 Reverse, 5'-TAGTTATTGCTCAGCGGTGG-3'. 11.

https://www.genscript.com/sequencing_primer.html

GenScript offers FREE Standard Primers for DNA sequencing. ... T7, 5'- TAA TAC GAC TCA CTA TAG GG -3'. T7-Ter, 5'- GCT AGT TAT TGC TCA GCG G -3'.

https://www.eurofinsgenomics.com/en/products/dna-sequencing/standard-primers/

In order to enable fast and convenient ordering of sequencing primers that are widely used to sequence inserts in standard cloning vectors, we have assembled  ...

https://www.fasteris.com/dna/?q=content/standard-primers

Standard primers; Specific primers. Standard ... T7, T7 Sequencing, 5'- TAATACGACTCACTATAGG-3'. SP6, SP6 Sequencing, 5'- GATTTAGGTGACACTATAG-3' ...

https://www.idtdna.com/pages/products/custom-dna-rna/readymade-inventoried-oligos/readymade-primers

ReadyMade Primers include random hexamers, T7 promoter/terminator, M13 primers, 16S rRNA primers, and varieties of oligo dT that are available for ...