Web Results

www.thermofisher.com/order/catalog/product/SO118

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 M aqueous solutions.Applications Sequencing of DNA fragments located down

www.addgene.org/mol-bio-reference/sequencing-primers

Addgene does not distribute primers. For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert. To identify primers that may be useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' sequencing primer" and "3' sequencing primer".

www.thermofisher.com/order/catalog/product/N56002

Invitrogen offers primers for PCR amplification that complement many of the vectors currently available. All primers are: Desalted and purified by gel filtration Assayed for function by PCR amplification Provided in 2 g quantityT7: 5- TAATACGACTCACTATAGGG- 3

openwetware.org/wiki/Common_primer_sequences

M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC

www.etonbio.com/sequencing/dna_sequencing_primer.php

DNA Sequencing - Primer. Universal Primer List; Primer Name: Primer Sequence 5'-3' T7 Promotor: TAA TAC GAC TCA CTA TAG GG : T7 Terminator: GCT AGT TAT TGC TCA GCG G: T3: ATT AAC CCT CAC TAA AGG GA: SP6: GAT TTA GGT GAC ACT ATA G : M13F(-21) TGT AAA ACG ACG GCC AGT: M13F(-40) GTT TTC CCA GTC ACG AC :

en.wikipedia.org/wiki/T7_DNA_polymerase

T7 DNA polymerase is an enzyme used during the DNA replication of the T7 bacteriophage.During this process, the DNA polymerase “reads” existing DNA strands and creates two new strands that match the existing ones. The T7 DNA polymerase requires a host factor, E. coli thioredoxin, in order to carry out its function. This helps stabilize the binding of the necessary protein to the primer ...

www.genewiz.com/Public/Resources/Free-Universal-Primers

Free Universal Primers. GENEWIZ offers a variety of free universal primers for sequencing. These free universal primers are being updated to reflect the needs of our customers. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below).

www.mclab.com/Primers-for-Sequencing.html

We also provide our customers free templates and primers storage in MCLAB's freezer archives for up to 12 months from the time of submission. This way when you order a re-sequencing or submit other templates to be sequenced by the same group of primers, what you need to do is just tell us which primer combination to use. It's just like that easy.

dna.macrogen.com/eng/support/ces/guide/universal_primer.jsp

Universal Primer The following list is our Universal Primers we provide for free of charge. * Please be aware that the sequences of each primer may differ depending on manufacturers.

www.neb.com/faqs/2015/01/30/what-is-the-promoter-sequence...

FAQ: What is the promoter sequence of T7 RNA Polymerase? T7 Promoter 5′ TAATACGACTCACTATA G 3′ T7 RNA polymerase starts transcription at the underlined G in the promoter sequence. The polymerase then transcribes using the opposite strand as a template from 5’->3’. The first base in the transcript will be a G.