https://www.addgene.org/mol-bio-reference/sequencing-primers/

CMV Forward, CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer. LKO.1 5', GACTATCATATGCTTACCGT ...

https://www.genewiz.com/en/Public/Resources/Free-Universal-Primers

GENEWIZ offers a variety of free universal primers for sequencing. ... have access to the Updated GENEWIZ Universal Primer list (see below). ... CMV- Forward.

https://www.lslabs.com/resources/universal-primer-list

Universal primers are PCR/sequencing primers that bind to a sequence found in many plasmid ... CMV-Forward, 5'-CGC AAA TGG GCG GTA GGC GTG-3'. 20.

https://www.fasteris.com/dna/?q=content/standard-primers

Standard primers; Specific primers ... CMV-IE, CMV-for, 5'- CGCAAATGGGCGGTAGGCGTG-3' ... pET-Fwd, pET-Forward, 5'- CGGCGTAGAGGATCGAGA-3'.

https://www.genscript.com/sequencing_primer.html

CMV-Forward, 5'- CGC AAA TGG GCG GTA GGC GTG -3'. CMV-R, 5'- GTT CAC GGT GCC CTC C -3'. PGEX-5', 5'- GGG CTG GCA AGC CAC GTT TGG TG -3'.

https://dnasu.org/DNASU/Primers.do

For a full list of vectors and their sequencing primers, go to our Vector/Primer page. If you are ... CMV forward, CGCAAATGGGCGGTAGGCGTG. DD122B ...

https://www.civicbio.com/product/cmv-forward-primer-100-%C2%B5m/

CMV Forward Primer (100 µM) CMV Forward primer is often used for DNA sequencing. Provided F-CMV (CMV Forward primer) 5'- AAATGGGCGGTAGGCGTG ...

https://www.etonbio.com/sequencing/dna_sequencing_primer.php

We offer a variety of free universal primers for your use. ... Primer Name, Primer Sequence 5'-3' ... CMV-Forward, CGC AAA TGG GCG GTA GGC GTG. LKO.1 5' ...

https://www.macrogenusa.com/support/seq/primer.jsp

CMV-F, CGCAAATGGGCGGTAGGCGTG, pFastBac_Forward, GGATTATTCATACCGTCCCA. CYC1_Reverse, GCGTGAATGTAAGCGTGAC, pFastBac_Reverse ...

https://www.abmgood.com/Documents/files/ABM%20Free%20Primers%20for%20DNA%20Sequencing%20Service-1.pdf

BK Reverse. BKRSV. Bluescript KS. Bluescript SK. CBDcena. CBDcexLEAD. CBDclos cl Forward. Cite primer. CMV Forward. CMV FP. CMV RP. CYC1 Reverse.