Web Results

www.addgene.org/mol-bio-reference/sequencing-primers

The primer sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert.

www.lslabs.com/resources/universal-primer-list

Universal Primer List Universal primers are PCR/sequencing primers that bind to a sequence found in many plasmid cloning vectors, most of which are derived from pUC vectors (which in turn come from pBR322).

www.sigmaaldrich.com/catalog/product/sigma/p5350

The N-CMV-30 sequencing primer is a chemically synthesized, 30 base, single strand oligodeoxyribonucleotide designed for dsDNA or ssDNA sequencing of FLAG ® fusion proteins at the C-terminus of the pFLAG-CMV expression vectors. The primer is complementary to map position nucleotides 818-847 of positive, coding DNA strand of the pFLAG-CMV vectors.

dna.macrogen.com/eng/support/ces/guide/universal_primer.jsp

Universal Primer The following list is our Universal Primers we provide for free of charge. * Please be aware that the sequences of each primer may differ depending on manufacturers.

www.macrogenusa.com/support/seq/primer.jsp

Maryland 1330 Piccard Drive Suite 205 Rockville, MD 20850 Tel. (301) 251-1007 customerservice@macrogenusa.com New York 760 Parkside Ave. Suite 120 Brooklyn, NY 11226

www.dnaseq.co.uk/resources/primers/standard-primers

Primer Name Primer Sequence (5'->3') Plasmid Specificity Comments; CMV Fwd: CGCAAATGGGCGGTAGGCGTG: At 5' end of MCS in pCMV5 (4) This is a "Universal" primer and should work in any vector that contains a CMV promoter.

www.etonbio.com/sequencing/dna_sequencing_primer.php

We offer a variety of free universal primers for your use.

www.genscript.com/sequencing_primer.html

For quotation requests and questions, contact us by phone, email, fax, via our secured online quotation system or submit your sequencing worksheets. Orders can be placed by phone, email, fax or online with a formal PO (Purchase Order) or credit card. Please send your samples together with a hard copy of the completed order summary to DNA Sequencing Service, GenScript, 860 Centennial Ave ...

www.ncbi.nlm.nih.gov/pmc/articles/PMC84872

We read with great interest the article by Mendez et al. published in a recent issue evaluating different PCR primers for cytomegalovirus (CMV) detection.As CMV PCR becomes a frequently used assay in the management of immunocompromised patients, such as transplant recipients and human immunodeficiency virus-infected individuals, an increasing number of laboratories are establishing in-house ...

www.addgene.org/vector-database/2093

Welcome to Vector Database!. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.. This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.