In
mathematics, a
subsequence of some
sequence is a new sequence which is formed from the original sequence by deleting some of the elements without disturbing the relative positions of the remaining elements.
Formally, suppose that X is a set and that (ak)k ∈ K is a sequence in X, where K = {1,2,3,...,n} if (ak) is a finite sequence and K = N if (ak) is an infinite sequence. Then, a subsequence of (ak) is a sequence of the form where (nr) is a strictly increasing sequence in the index set K.
Example
As an example,
is a subsequence of
- ,
with corresponding index sequence <3,7,9,11>.
Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. For example, if
- and
then common subsequence of
X and
Y could be
This would not be the longest common subsequence, since G only has length 3, and the common subsequence < B,E,E,B > has length 4. The longest common subsequence of X and Y is < B,E,G,C,E,B >.
Applications
Subsequences have applications to
computer science, especially in the discipline of
Bioinformatics, where computers are used to compare, analyze, and store
DNA strands.
Take two strands of DNA, say :
ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.
Substring vs. subsequence
In computer science,
string is often used as a synonym for
sequence, but it is important to note that
substring and
subsequence are not synonyms. Substrings are consecutive parts of a string, while subsequences need not be. This means that a substring of a string is always a subsequence of the string, but the subsequence of a string is not always a substring of the string.
See also
References